International Journal of Negative Results

International Journal of Negative Results

International Journal of Negative Results

Current Issue Volume No: 1 Issue No: 1

Letter Open Access Available online freely Peer Reviewed Citation

Evidence for the Absence of La Crosse Virus, Rift Valley Fever Virus, and Bunyamwera Virus in Korean Domestic Pigs

Article Type: Letter

1Department of Veterinary Medicine Virology Laboratory, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul, Korea.

2Department of Veterinary Microbiology and Infectious Diseases, Faculty of Veterinary Medicine, Vietnam National University of Agriculture, Hanoi 100000, Vietnam

Abstract

A surveillance study reports no detection of targeted bunyaviruses in domestic pigs in Korea. Methods, sampling frame, and assay limits are described to contextualize interpretation and surveillance value.

Author Contributions
Received 18 Sep 2017; Accepted 09 Oct 2017; Published 19 Oct 2017;

Academic Editor: Huseyin Bekir YILDIZ, Professor Doctor in Department of Materials Science and Nanotechnology Engineering, KTO Karatay University, Konya, Turkey

Checked for plagiarism: Yes

Review by: Single-blind

Copyright ©  2017 Hee-Chun Chung, et al

License
Creative Commons License     This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Competing interests

The authors have declared that no competing interests exist.

Citation:

Hee-Chun Chung, Van-Giap Nguyen, Bong-Kyun Park (2017) Evidence for the Absence of La Crosse Virus, Rift Valley Fever Virus, and Bunyamwera Virus in Korean Domestic Pigs. International Journal of Negative Results - 1(1):1-4. https://doi.org/10.14302/issn.2641-9181.ijnr-17-1778

Download as RIS, BibTeX, Text (Include abstract )

DOI 10.14302/issn.2641-9181.ijnr-17-1778

Letter

Until today, several viruses of family Bunyaviridaesuch as severe fever thrombocytopenia syndrome virus (SFTSV), Rift Valley fever virus (RVFV), Sandfly fever Naples virus (SFNV), La Crosse virus (LACV), and Bunyamwera virus (BUNV) are known as zoonotic pathogens 1, 2, 3. An outbreak of RVFV (Phlebovirus) in developed countries including U.S and Europe, could force a curtailing of livestock movement to prevent RVFV spread, causing massive loss because of high rates mortality and abortion in pregnant sheep, cattle, and goat 4. Reported cases due to LACV and BUNV, members of the genus Orthobunyavirus, have been increased in North America, South America, Africa, and Europe 1, 3. LACV, RVFV, and BUNV are transmitted by mosquitoes (Culex spp., Aedes spp., etc) which are known to prevail in Korea 5.

This study aimed to investigate the presence of LACV, RVFV, and BUNV in pigs in Korea, on the basic of regional and individual farm surveillance. From January to November, 2013, a total of 586 pig bloods were randomly collected from 45 commercial swine farms in 9 provinces (Supplementary Figure 1).

Total RNA of these samples was extracted using Trizol LS (Invitrogen, USA) following the

manufacturer’s instructions. The RNA was then converted into cDNA with the use of random hexamers and commercial M-MLV reverse transcriptase kit (Invitrogen, USA) following the manufacturer’s protocol. PCR reactions were performed with pathogen-specific primers using Maxime PCR PreMix kit (iNtRON, Korea). The specific primers (given in 5’ to 3’ direction) for each of LACV, RVFV, and BUNV are given in Supplementary Table 1 Each of viruses (LACV, RVFV, and BUNV) positive controls were used by the Bioneer, Corporation, Korea (AccuGeneBlock synthetically service).

The PCR profile was 95oC for 5 min; 38 cycles of 95oC for 20 s, 56oC for 30 s, 72oC for 40 s; and final extension at 72oC for 10 min. Of the total 586 samples, none were found to be positive with LACV, RVFV, and BUNV. Also, no positive samples were detected according to seasons of the year (Table 1).

Table 1. RT-PCR screening results according to the age and month
  No. of positive   No. of positive (positive rate %)
Age * (positive rate %) Month
  LACV RVFV BUNV   LACV RVFV BUNV
Gilt (n=69) 0 0 0 January (n=42) 0 0 0
Sow (n=106) 0 0 0 February(n=43) 0 0 0
Suckling (n=96) 0 0 0 March (n=40) 0 0 0
Weaned (n=90) 0 0 0 April (n=40) 0 0 0
Grower (n=105) 0 0 0 May (n=64) 0 0 0
Finisher (n=120) 0 0 0 June (n=72) 0 0 0
        July (n=79) 0 0 0
        August (n=69) 0 0 0
September (n=49) 0 0 0
October (n=51) 0 0 0
November (n=37) 0 0 0
Grand total 0 0 0 Grand total 0 0 0
(n=586) (n=586)

* Samples were sorted into six groups: female (gilt and sow), suckling (<30 days), weaned (30-60 days), grower (60-90 days); and finisher (≥90 days)

In conclusion, this preliminary survey found no evidence for the presence of LACV, RVFV, and BUNV in pigs, in Korea. In the next phase, attempts will be done for serological survey against the above mentioned viruses. In addition, because LACV, RVFV, and BUNV are arthropod-borne viruses, it is important to examine mosquitoes for the presence of the viruses.

Acknowledgments

This study was supported by a grant (#PJ009015) from BioGreen 21Program, Republic of Korea.

Author Disclosure Statement

No competing financial interests exist.

Supplementary data:

Supplementary Table 1. Sequences of specific primers used in this study
Virus Primer Targetgene Sequence (5’-3’) Size (bp)
La crosse virus LACV-F S GGCATTCACAGAGTCAAGCA 361bp
LACV-R TTTTTGCTGTCC CCTACCAC
Rift valley fever virus RVFV-F S ACAAGCCCAAAAGCTTTCAA 444bp
RVFV-R GAAAGAAGGCAAGGCAACG
Bunyamwera virus BUNV-F M CGATCACAGACTGGAAAGCA 527bp
BUNV-R ACTCCTGTTGTACGCCCATC

Supplementary Figure 1.Locations of investigated swine farms for LACV, RVFV, and BUNV.
International Journal of Negative Results-LACV

References

  1. 1.Lambert A J, Blair C D, D'Anton M, Ewing W, Harborth M et al. (2010) La Crosse virus in Aedes albopictus mosquitoes. , Texas, USA, Emerging Infectious Diseases 16, 856-858.
  1. 2.Kim K H, Yi J, Kim G, Choi S J, Jun K I et al. (2013) Severe fever with thrombocytopenia syndrome, South Korea. , Emerging Infectious Diseases 19, 1892-1894.
  1. 3.Pachler K, Růžek D, Nowotny N. (2013) Molecular characterization of the African orthobunyavirus Ilesha virus. , Infection, Genetics and Evolution 20, 124-130.
  1. 4.Coetzer J. (1982) The pathology of Rift Valley fever. II. Lesions occurring in field cases in adult cattle, calves and aborted foetuses. , The Onderstepoort Journal of Veterinary Research 49, 11.
  1. 5.Cha G, Jeong Y, Lee E, Kang B, Lee E et al. (2012) Detection of new flavivirus from Ades mosquito in South Korea,2011. , International Journal of Infectious Diseases 16, 249.